View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_high_79 (Length: 250)
Name: NF2324_high_79
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_high_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 54727496 - 54727268
Alignment:
| Q |
1 |
attgttttacattgttatgttgaataagttaagtgttgtttaggactataatcttgagaaattatgaaaataattggaannnnnnnnnnnnnn-caatga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54727496 |
attgttttacattgttatgttgaataagttaagtgttgtttaggactataatcttgagaaattatgaaaataattggaatttttttatttttttcaatga |
54727397 |
T |
 |
| Q |
100 |
aggttgtaagatctggtgatttggtttcttactgtgctgaagaaggagtaaggattcttggagagggaaagtttctggtttcagatagctttccgggaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54727396 |
aggttgtaagatctggtgatttggtttcttactgtgctgaagaaggagtaaggattcttggagagggaaagtttctggtttcagatagctttccgggaaa |
54727297 |
T |
 |
| Q |
200 |
tgaaaggaccaaatattgcctcacttcca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54727296 |
tgaaaggaccaaatattgcctcacttcca |
54727268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 100 - 223
Target Start/End: Original strand, 3007255 - 3007378
Alignment:
| Q |
100 |
aggttgtaagatctggtgatttggtttcttactgtgctgaagaaggagtaaggattcttggagagggaaagtttctggtttcagatagctttccgggaaa |
199 |
Q |
| |
|
||||||| ||||| || |||||||| || || ||||| || ||||||||||| ||||| ||||| |||||||||||||| || ||||| ||||| || || |
|
|
| T |
3007255 |
aggttgttagatcaggggatttggtgtcatattgtgccgaggaaggagtaagaattctcggagaaggaaagtttctggtgtctgatagttttccaggcaa |
3007354 |
T |
 |
| Q |
200 |
tgaaaggaccaaatattgcctcac |
223 |
Q |
| |
|
|||||| |||||||| || ||||| |
|
|
| T |
3007355 |
tgaaagaaccaaatactgtctcac |
3007378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University