View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_high_88 (Length: 238)
Name: NF2324_high_88
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_high_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 3 - 184
Target Start/End: Original strand, 49820197 - 49820378
Alignment:
| Q |
3 |
tatctagtccagtccatccatctattattatcaaaatccatccaattcattcattcattttgtcatcactaattctcctacccattatatgtggcatcaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49820197 |
tatctagtccagtccatccatctattattatcaaaatccatccaattcattcattcattttgtcatcactaatcctcctacccattatatgtggcatcaa |
49820296 |
T |
 |
| Q |
103 |
aatttaacaatttattaggtctttaatatcctcgattaaggtgttctcatttatcatatgctttatgccatttcgcactact |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49820297 |
aatttaacaatttattaggtctttaatatcctcgattaaggtgttctcatttatcatatactttatgccatttcgcactact |
49820378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 49821100 - 49821145
Alignment:
| Q |
176 |
cgcactactcatcccaccagcatcacaatgacactactactatatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49821100 |
cgcactactcatcccaccagcatcacaatgacactactactatatg |
49821145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University