View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2324_high_96 (Length: 230)

Name: NF2324_high_96
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2324_high_96
NF2324_high_96
[»] chr5 (1 HSPs)
chr5 (18-137)||(8509865-8509984)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 18 - 137
Target Start/End: Original strand, 8509865 - 8509984
Alignment:
18 attaaaattggatagaagtagaactatagaagaacactagcaactatcaaatttgtaaaataactatgaaatataccccacaccctattccaccctgcaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8509865 attaaaattggatagaagtagaactatagaagaacactagcaactatcaaatttgtaaaataactatgaaatataccccacaccctattccaccctgcaa 8509964  T
118 aatccctttgcatatcatga 137  Q
    ||||||||||||||||||||    
8509965 aatccctttgcatatcatga 8509984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University