View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_100 (Length: 237)
Name: NF2324_low_100
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_100 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 23 - 147
Target Start/End: Original strand, 22074087 - 22074211
Alignment:
| Q |
23 |
atgttgttctataaatgaagttaaccacgcttttggaagtgaaaaagatatagtttgacattttcccatgcatggtctcaattgtactctgctatcttat |
122 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22074087 |
atgtttttctataaatgaagttaaccacgcttttggaaggggaaaagatatagtttgacatttttccatgcatggtctcaattgtactctgctatcttat |
22074186 |
T |
|
| Q |
123 |
tgaaaagagtaatagaaggaaagga |
147 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
22074187 |
tgaaaagagtaatagaaggaaagga |
22074211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 142 - 229
Target Start/End: Original strand, 22076346 - 22076433
Alignment:
| Q |
142 |
aaaggacagttagcttttggtagagtggctaatgtaggagaaagtgggatttgacattactgttgaagcaggtaaattgatgatgatg |
229 |
Q |
| |
|
||||||| |||| ||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22076346 |
aaaggaccgttaatttttggtagaggggctaatgtaggagaaagtggaatttgacattactgttcaagcaggtaaattgatgatgatg |
22076433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University