View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_108 (Length: 230)
Name: NF2324_low_108
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_108 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 56378399 - 56378613
Alignment:
| Q |
19 |
agaactaccaccatcactcagccttcaatttcaacttcaacagacagcagcaccaccacagcatgaggaaattcatgttacctcttcctgatcaggctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56378399 |
agaactaccaccatcactcagccttcaacttcaacttcaacagacagcagcaccaccacagcatgaggaaattcatgttacctcttcctgatcaggctct |
56378498 |
T |
 |
| Q |
119 |
tggtcttggctaccaccaccaccactctattcctaatacagcatcagcagcagcaacaggt---aacaacaacattcttccttctagagctgtagcgcca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
56378499 |
tggtcttggctaccaccaccaccactctactcctaatacagcatcagcagcagcaacaggtaacaacaacaacattcttccttctagagctgtagcgcca |
56378598 |
T |
 |
| Q |
216 |
cctcatggacatggc |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
56378599 |
cctcatggacatggc |
56378613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University