View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_110 (Length: 225)
Name: NF2324_low_110
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_110 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 11 - 207
Target Start/End: Complemental strand, 2443566 - 2443358
Alignment:
| Q |
11 |
tgagaagaaaatctgaaaggtgcgtggttgatttggcattccaagcttttggtgatttgcagggtgcggaacgaaaggatttgatgcaaccaagtgaggg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2443566 |
tgagaagaaaatctgaaaggtgcgtggttgatttggcattccaagcttttggtgatttgcagggtgaggaacgaaaggatttgatgcaaccaagtgaggg |
2443467 |
T |
|
| Q |
111 |
agatt------------gatgggataaaagtgttatctttgcattagagtttgagtagattgaaaatacatgcgtcaactgctttttaaggttggttgct |
198 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2443466 |
agattgatgaagtaattgatgggataaaagtgttatctttgcattagagtttgagtagattgaaaatacatgcgtcaactgctttttaaggttggttgct |
2443367 |
T |
|
| Q |
199 |
gtcttgtct |
207 |
Q |
| |
|
||||||||| |
|
|
| T |
2443366 |
gtcttgtct |
2443358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University