View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_113 (Length: 218)
Name: NF2324_low_113
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_113 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 25 - 137
Target Start/End: Original strand, 38330256 - 38330368
Alignment:
| Q |
25 |
gttaaaactacgttaaaagttgataccaacacttcttttaggagggaaatgtgatagctattctatgtttttaactcaggatccgtttgatgcgcatgat |
124 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38330256 |
gttaaaactacgttaaaagtggataccaacacttcttttaggaggaaaatgtgatagttattctatgtttttaactcaggatctgtttgatgcgcatgat |
38330355 |
T |
 |
| Q |
125 |
acaatagaaacat |
137 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38330356 |
acaatagaaacat |
38330368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University