View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2324_low_113 (Length: 218)

Name: NF2324_low_113
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2324_low_113
NF2324_low_113
[»] chr1 (1 HSPs)
chr1 (25-137)||(38330256-38330368)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 25 - 137
Target Start/End: Original strand, 38330256 - 38330368
Alignment:
25 gttaaaactacgttaaaagttgataccaacacttcttttaggagggaaatgtgatagctattctatgtttttaactcaggatccgtttgatgcgcatgat 124  Q
    |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
38330256 gttaaaactacgttaaaagtggataccaacacttcttttaggaggaaaatgtgatagttattctatgtttttaactcaggatctgtttgatgcgcatgat 38330355  T
125 acaatagaaacat 137  Q
    |||||||||||||    
38330356 acaatagaaacat 38330368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University