View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_114 (Length: 217)
Name: NF2324_low_114
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_114 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 38 - 200
Target Start/End: Original strand, 46030499 - 46030657
Alignment:
| Q |
38 |
aaaaactcacatatatgacaaacaagaaagtttagtgactaccacagaaaggtttgtcaagtttaataatattgattgatttattggttttctggtagaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46030499 |
aaaaactcacatatatgacaaacaagaaagtttagtgactgccacagaaaggtttgtcaagtttaataatattg----atttattggttttctggtagaa |
46030594 |
T |
 |
| Q |
138 |
ataaatacacatgccatgacacaacaaaatttcaccaaatctaggttttatctcggaatttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46030595 |
ataaatacacatgccatgacacaacaaaatttcaccaaatctaggttttatctcggaatttct |
46030657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University