View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_115 (Length: 216)
Name: NF2324_low_115
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_115 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 37308884 - 37309088
Alignment:
| Q |
1 |
atgcttgtgtttctaaaaaatatttaatggggttgaagtatagtgtgtgtggacattttattgtcagataaaccttgagcaacagttttatttggtgaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
37308884 |
atgcttgtgtttctaaaaaatatttaatggg-ttgaagtagtgtgtgtgtggacattttattgtcagataagccttgaggaacagttttatttggtgaga |
37308982 |
T |
 |
| Q |
101 |
cttttattgaaatatgaaatttcttcgttgataataaattataccgtaaatgttttataagtgtagcaaccaaggttattaattgtaagggtcaagattc |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
37308983 |
cttttc----------aaatttcttcgttgataataaattataccgtaaatgttttataagtgtagcaaccaaggtcattatttgtaagggtcaagattc |
37309072 |
T |
 |
| Q |
201 |
agacttcagatttctc |
216 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
37309073 |
agatttcagatttctc |
37309088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University