View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_48 (Length: 377)
Name: NF2324_low_48
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 9e-92; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 146 - 320
Target Start/End: Original strand, 45075494 - 45075668
Alignment:
| Q |
146 |
tgtttagaaaaatgacaatattagtaaaaatgagggtgacaaatatagcaaatgaaagacaaaaatctagatagtgtaacagcttcaactatgcattgac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45075494 |
tgtttagaaaaatgacaatattagtaaaaatgagggtgacaaatatagcaaatgaaagacaaaaatctagatagtgtaacagcttcaactatgcattgac |
45075593 |
T |
|
| Q |
246 |
atttttataatgtccatcaatgctgatccgatctactagaatctaattagttaatgaagttggaacaattgaatt |
320 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45075594 |
atttttataatgcccatcaatgctgatccgatctactagaatctaattagttaatgaagttggaacaattgaatt |
45075668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 45075399 - 45075473
Alignment:
| Q |
1 |
tagaatacaaattatggaagaggccattgtttgtcggtgtcagttggatccgactgacaaacaatggcctcgtcc |
75 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45075399 |
tagaatacaaattatggaagaggtcattgtttgtcggtgtcagttggatccgactgacaaacaatggcctcgtcc |
45075473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 328 - 361
Target Start/End: Original strand, 45075697 - 45075730
Alignment:
| Q |
328 |
ccttgttgtgtttgttgaagttggaagagagatg |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45075697 |
ccttgttgtgtttgttgaagttggaagagagatg |
45075730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University