View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_51 (Length: 366)
Name: NF2324_low_51
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 233
Target Start/End: Complemental strand, 32119684 - 32119463
Alignment:
| Q |
12 |
aagaaccaccagcatagcattgcgaatacttgctatgatctcagctaataattccgacaatccttgaggaaccagtgctggttgcgatatggttaagtta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32119684 |
aagaaccaccagcatagcattgcgaatacttgctacgatctcagctaataattccgacaatccttgaggaaccagtgctggttgcgatatggttaagtta |
32119585 |
T |
|
| Q |
112 |
ttggtggtagtcatggttgccttcattaccacaaccggcttcctttctactttctcgggtaaaactttgatattatctcctctcaaacatgccatacttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32119584 |
ttggtggtagtcatggttgccttcattaccaccaccggcttcctttctactttctcgggtaaaactttgatattatctcctctcaaacatgccagacttt |
32119485 |
T |
|
| Q |
212 |
gataccgtacacatttcgtata |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32119484 |
gataccgtacacatttcgtata |
32119463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 273 - 342
Target Start/End: Complemental strand, 32119423 - 32119354
Alignment:
| Q |
273 |
ttggtcaaatggcaccttagagtgttgcaacaatctagaggttgccattgatctcaactgaattgaacaa |
342 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32119423 |
ttggtcaaatggaaccttagagtgttgcaacaatctagaggttgccattgatctcaattgaattgaacaa |
32119354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University