View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_61 (Length: 337)
Name: NF2324_low_61
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 308; Significance: 1e-173; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 19 - 326
Target Start/End: Original strand, 30805138 - 30805445
Alignment:
| Q |
19 |
gtttgggtgtctgctgtggaggcttattttacggcagcagggaccgctggggcggagacggcgaaaggggtgtttttagggctgttaggtaggtgtcatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805138 |
gtttgggtgtctgctgtggaggcttattttacggcagcagggaccgctggggcggagacggcgaaaggggtgtttttagggctgttaggtaggtgtcatg |
30805237 |
T |
|
| Q |
119 |
ttagtgctggtgccgcggtgagggtggcgagtagggtgctcggaggcagtggagaagggagtaaagtgagggctaaagtggttgctgagcttgtgtctga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805238 |
ttagtgctggtgccgcggtgagggtggcgagtagggtgctcggaggcagtggagaagggagtaaagtgagggctaaagtggttgctgagcttgtgtctga |
30805337 |
T |
|
| Q |
219 |
tgaaagggtagtggcgctttttgcagaaaaggatgctgctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattactttt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805338 |
tgaaagggtagtggcgctttttgcagaaaaggatgctgctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattactttt |
30805437 |
T |
|
| Q |
319 |
gggttcat |
326 |
Q |
| |
|
|||||||| |
|
|
| T |
30805438 |
gggttcat |
30805445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 257 - 326
Target Start/End: Original strand, 30806812 - 30806881
Alignment:
| Q |
257 |
ctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattacttttgggttcat |
326 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
30806812 |
ctaaggatagaacagcaatgcatgctgttctttggaattggtatgataatgttattactctttggttcat |
30806881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University