View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2324_low_72 (Length: 300)

Name: NF2324_low_72
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2324_low_72
NF2324_low_72
[»] chr7 (1 HSPs)
chr7 (22-283)||(35373211-35373457)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 283
Target Start/End: Complemental strand, 35373457 - 35373211
Alignment:
22 ttgaacacaaactaaaattgctagttattgccttatatagaaatgtcgaaaagttattgacaaaaattaatcgctcaagtaatatcgataaattgagata 121  Q
    ||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||    
35373457 ttgaacacaaactaaaattgctagtt---gccttatatagaaatgtcgaaaagttattgacaaaaattaatcgatcaagtaatatcgataaatcgagata 35373361  T
122 taaaatgaaagtaaccattcacttttagtagtaatttcaaaacatcttaaatttaaatagcataaatggannnnnnnnnnnnnnnnnagaacatacatgg 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||                  |||||||||||||    
35373360 taaaatgaaagtaaccattcacttttagtagtaatttcaaaacatcttaaatttaaatagcatacatgg------------ttttttagaacatacatgg 35373273  T
222 aaatcttagagttcaaaaactccggtcaaccttcatgttttgataatgaaaaacaaactttg 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35373272 aaatcttagagttcaaaaactccggtcaaccttcatgttttgataatgaaaaacaaactttg 35373211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University