View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_72 (Length: 300)
Name: NF2324_low_72
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 283
Target Start/End: Complemental strand, 35373457 - 35373211
Alignment:
| Q |
22 |
ttgaacacaaactaaaattgctagttattgccttatatagaaatgtcgaaaagttattgacaaaaattaatcgctcaagtaatatcgataaattgagata |
121 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
35373457 |
ttgaacacaaactaaaattgctagtt---gccttatatagaaatgtcgaaaagttattgacaaaaattaatcgatcaagtaatatcgataaatcgagata |
35373361 |
T |
 |
| Q |
122 |
taaaatgaaagtaaccattcacttttagtagtaatttcaaaacatcttaaatttaaatagcataaatggannnnnnnnnnnnnnnnnagaacatacatgg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
35373360 |
taaaatgaaagtaaccattcacttttagtagtaatttcaaaacatcttaaatttaaatagcatacatgg------------ttttttagaacatacatgg |
35373273 |
T |
 |
| Q |
222 |
aaatcttagagttcaaaaactccggtcaaccttcatgttttgataatgaaaaacaaactttg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35373272 |
aaatcttagagttcaaaaactccggtcaaccttcatgttttgataatgaaaaacaaactttg |
35373211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University