View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2324_low_83 (Length: 266)

Name: NF2324_low_83
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2324_low_83
NF2324_low_83
[»] chr5 (1 HSPs)
chr5 (37-103)||(26454052-26454118)


Alignment Details
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 37 - 103
Target Start/End: Complemental strand, 26454118 - 26454052
Alignment:
37 tgttataggtcgaatttagtttttctataaatgatagagttgtagattgttttattacgtgttaaat 103  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26454118 tgttataggttgaatttagtttttctataaatgatagagttgtagattgttttattacgtgttaaat 26454052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University