View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_93 (Length: 248)
Name: NF2324_low_93
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_93 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 98 - 248
Target Start/End: Original strand, 34319677 - 34319833
Alignment:
| Q |
98 |
cgcaggcaagtgctgaatgtcaccaagcagaaaccaacgtgattggttattttcgagattaaatgaaaacgttttccttttcctctctaaaataataata |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34319677 |
cgcagacaagtgctgaatgtcaccaagcagaaatcaacgtgattggttattttcgagattaaatgaaaacgttttccttttcctctctaaaataataata |
34319776 |
T |
|
| Q |
198 |
------ctaacacgttggtgaaaggtgagtgatgtaatatacgcgtgttcatacttt |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34319777 |
ctaactctaacacgttggtgaaaggtgggtgatgtaatatacgcgtgttcatacttt |
34319833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University