View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_low_94 (Length: 246)
Name: NF2324_low_94
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_low_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 43736599 - 43736383
Alignment:
| Q |
20 |
gaaataccaagtactaaccaaattgagttcttctctaattttggtttggtagcaaacagttttagatttaattaattacaatat--tgtgaccagaccag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | | ||||||||||| |
|
|
| T |
43736599 |
gaaataccaagtactaaccaaattgagttcttctctaattt-----tggtagcaaacagttttagatttaattaattacattgtgaccagaccagaccag |
43736505 |
T |
 |
| Q |
118 |
accagcatgacatgactattattgagtgaacaatttgttgaggattggattctgcacctaagaggcctctttttcatgatgaacgcgactcgctcgtata |
217 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43736504 |
accagcatgacatgactattattaagttaacaatttgttgtggattggattctgcacctaagaggcctctttttcatgatgaacgcgactcgctcgtata |
43736405 |
T |
 |
| Q |
218 |
gttaaccgttcctccttctctg |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43736404 |
gttaaccgttcctccttctctg |
43736383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University