View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2325_high_17 (Length: 299)
Name: NF2325_high_17
Description: NF2325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2325_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 286
Target Start/End: Complemental strand, 40669066 - 40668798
Alignment:
| Q |
18 |
attcaaaagtgatttcttcgtcttttcgggctccaagtcttcaaatgtttgctatccgctcaggtttgaaatttctcaaaatgtctacaatacaacccct |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40669066 |
attcaaaagtgatttcttcgtcttttcaggctccaagtcttcaaatgtttgctatccgctcaggtttgaaatttctcaaaatgtctacaatacaacccct |
40668967 |
T |
 |
| Q |
118 |
ggtattctattgcaaggtgtaacctgcgacttggtttatgattatgtataattgagatggagtatgtaatcccacttagttataggaatgtgattgcatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40668966 |
ggtattctattgcaaggtgtaacctgcgacttgggttatgattatgtataattgagatggagtatgtaatcccacttagttataggaatgtgattgcatt |
40668867 |
T |
 |
| Q |
218 |
tagctagtgatctcaatttataaaatattaattaatatttacatttacatgtttaagatgtgggagttc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40668866 |
tagctagtgatctcaatttataaaatattaattaatatttacatttacatgtttaagatgtgggagttc |
40668798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University