View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2325_high_8 (Length: 401)
Name: NF2325_high_8
Description: NF2325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2325_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 113 - 399
Target Start/End: Complemental strand, 44611793 - 44611507
Alignment:
| Q |
113 |
ctgttggatgaaaatcggatgattttgatttaagacataacttaaaatataatccgaacaatcttcatccaatgactgaaatttttcacgtatagaatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44611793 |
ctgttggatgaaaatcggatgattttgatttaagacataacttaaaatataatccgaacaatcttcatccaacgactgaaatttttcatgtatagaatcc |
44611694 |
T |
|
| Q |
213 |
attccttctaatacctgcttctctgacaggagggaatcaggatcctctaaagtataccttgaacataggtgtgatggggcttccagctggaactttggtt |
312 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44611693 |
attccttcaaatacctgcttctctgacaggagggaatcaggatcctctaaagtgtaccttgaacataggtgtgatggggcttccagctggaactttggtt |
44611594 |
T |
|
| Q |
313 |
ctatacttgtgtgaaccaagaagaaaaactggaatggagagcaatattgaagcagttgatacacctaaaccccactgccatcctttg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44611593 |
ctatacttgtgtgaaccaagaagaaaaactggaatggagagcaatattgaagcagttgatacacctaaaccccactgccatcctttg |
44611507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 44611843 - 44611790
Alignment:
| Q |
18 |
gatcttatagtttagatcctatgaccacgtcaaatgctgacttgatttccctgt |
71 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44611843 |
gatcttatagtttagatcctatgaccgcgtcaaatgctgacttgatttccctgt |
44611790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University