View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2325_low_17 (Length: 318)
Name: NF2325_low_17
Description: NF2325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2325_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 3 - 313
Target Start/End: Original strand, 53793886 - 53794195
Alignment:
| Q |
3 |
aattaattaatgattatatctcattctctagtttcgttttcggcattaaacttgtttggatgattctactaacnnnnnnncttgtttgtattaaatgcaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53793886 |
aattaattaatgattatatctcattctctagtttcgttttcggcattaaacttgtttggatgattctactaacaaaaaaacttgtttgtattaaatgcaa |
53793985 |
T |
 |
| Q |
103 |
tgtttttctaggcggctttgggttaatagtaatggatcattaaaataattttttcttatgagttttttctgatttctatgttattgtttatggtgtattc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53793986 |
tgtttttctaggcggctttgggttaatagtaatggatcattaaaataattttttcttatgagtttt-tctgatttctatgttattgtttatggtgtattc |
53794084 |
T |
 |
| Q |
203 |
agggtgctttgtcttccgcagattttgttcttctcctgtatttagcatcatcttataatatcttgtgctccgccatgcagtttattttaataaaagtttc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53794085 |
agggtgctttgtcttccgcagattttgttcttgtcctgtatttagcatcatcttataatatctggtgctccgccatgcagtttattttaataaaagtttc |
53794184 |
T |
 |
| Q |
303 |
cctttgcttct |
313 |
Q |
| |
|
|||||||||| |
|
|
| T |
53794185 |
tctttgcttct |
53794195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University