View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2325_low_23 (Length: 269)
Name: NF2325_low_23
Description: NF2325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2325_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 9 - 261
Target Start/End: Original strand, 1108949 - 1109200
Alignment:
| Q |
9 |
cccttgagagtcaagtaatagaaggaaaggaaaataggaaaataatttgcatagcttcctttatgattctaaatatttcgtagnnnnnnnn--aatcaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
1108949 |
cccttgagagtcaagtaatagaaggaaaggaaaataggaaaataatttgcatagtttcctttatgattctaaatatttcatagttttttttttaatcaat |
1109048 |
T |
 |
| Q |
107 |
atcatctgcatgtaactacaaatattaatatctcgaaccagatagaaccacaataagtaacaatgctctcccacaagagatttaacactcttgcattctc |
206 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1109049 |
atcatcttcatgcaactacaaatattaatatc--gagccagatagaaccacaataagtaacaatgctctcccacaagagatttaaca-tcttgcattctc |
1109145 |
T |
 |
| Q |
207 |
atgactagtttttaatttgttcatagatattgttcgttcaaaaatatttttctaa |
261 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
1109146 |
atgactagtttttaatttgtttatagatattgttcgtgcaaaaatatttttctaa |
1109200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University