View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2325_low_27 (Length: 223)
Name: NF2325_low_27
Description: NF2325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2325_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 35820098 - 35819971
Alignment:
| Q |
1 |
aaagccatcggatttattttttggttatgtatccacttttcagtattatttactagacagcatctattgagactttctttagcgatttagtttataattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35820098 |
aaagccatcggatttattttttggttatgtatccacttttcagtattatttactagacagcatctattgagactttctttagcgatttagtttataattt |
35819999 |
T |
|
| Q |
101 |
gaatatactaaaatgtagatcaacaact |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
35819998 |
gaatatactaaaatgtagatcaacaact |
35819971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University