View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2325_low_8 (Length: 410)
Name: NF2325_low_8
Description: NF2325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2325_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 4e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 4 - 208
Target Start/End: Original strand, 8931317 - 8931526
Alignment:
| Q |
4 |
taacaaaataaacatggaagatgatttttcttatgtacnnnnnnnnn-gtaagagcatatatttttcttatctact----taaatcatgtgagtgatgat |
98 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8931317 |
taacaaaatatacatggaagatgatttttgttatgtacttttttttttgtaagagcatatatttttcttatctacttacttaaatcatgtgagtgatgat |
8931416 |
T |
|
| Q |
99 |
aaaatcaacaatcatgcatggctattttttcacattgcgacaaattaaccagtgtttatcaatcatcatactaaatgcttctccactcaacgagagaaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931417 |
aaaatcaacaatcatgcatggctattttttcacattgcgacaaattaaccagtgtttatcaatcatcatactaaatgcttctccactcaacgagagaaac |
8931516 |
T |
|
| Q |
199 |
aattcattcc |
208 |
Q |
| |
|
|||||||||| |
|
|
| T |
8931517 |
aattcattcc |
8931526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 294 - 393
Target Start/End: Original strand, 8931612 - 8931711
Alignment:
| Q |
294 |
ggatggcacgccagcttttgagatgagaaagcgattcagcactaaggtactctacaaggcttgctgttgcatttctcctgcttaagctttatcagcatac |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931612 |
ggatggcacgccagcttttgagatgagaaagcgattcagcactaaggtactctacaaggcttgctgttgcatttctcctgcttaagctttatcagcatac |
8931711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University