View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2326_high_15 (Length: 236)
Name: NF2326_high_15
Description: NF2326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2326_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 31 - 226
Target Start/End: Original strand, 14862821 - 14863016
Alignment:
| Q |
31 |
ttcctcagagtaatcatgctgagcctcaaaacatgtttcttgagacatgacagttgagcttggatgatcttcttcactagtctgagtctccgactttgtc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14862821 |
ttcctcagagtaatcatgctgagcctcaaaacatgtttcttgagacatgacagttgagcttggatgatcttcttcactagtctgagtctctgactttgtc |
14862920 |
T |
 |
| Q |
131 |
aattctatggcacgactgacagttccatgcacaatctggccgcttgtgtctttactgatttgatcagcagtggtagagttttctaactgtgtgatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14862921 |
aattctatggcacgactgacagttccatgcacaatctggccgcttgtgtctttactgatttgatcagcagtggtagagttttctaattgtgtgatg |
14863016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University