View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2326_high_16 (Length: 232)

Name: NF2326_high_16
Description: NF2326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2326_high_16
NF2326_high_16
[»] chr5 (1 HSPs)
chr5 (1-221)||(5188274-5188494)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5188494 - 5188274
Alignment:
1 tacaaggaatattccgatgacataatattaattgacttggaatacttaattctcataaaaataagcatgctgaagtacgttgccttgcatatgccatata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5188494 tacaaggaatattccgatgacataatattaattgacttggaatacttaattctcataaaaataagcatgctgaagtacgttgccttgcatatgccatata 5188395  T
101 gtatattcttttagcaaatagtagatgccaacaataatagtggag-nnnnnnnnnggaagaagaaagaaaaataatagtgaagttatcgaatgggttggt 199  Q
    |||||| ||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||| |||||||    
5188394 gtatatccttttagcaaatagtagatgccaacaataatagtggagttttttttttggaagaagaaagaaaaataatagtgaagttatcgaat-ggttggt 5188296  T
200 ctccctctaagatattcttgga 221  Q
    |||||||||||||||| |||||    
5188295 ctccctctaagatatttttgga 5188274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University