View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2326_low_19 (Length: 253)
Name: NF2326_low_19
Description: NF2326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2326_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 234
Target Start/End: Complemental strand, 35989848 - 35989626
Alignment:
| Q |
12 |
gagagagaagaaggtaagtgaaggagaagagaaaaaacaagatacaagaatctagaacttggtggagtgtaattgatttggaggttgtgggagttattat |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35989848 |
gagagagaaaaaggtaagtgaaggagaagagaaaaaacaagatacaagaatctagaacttggtggagtgtaattgatttggaggttgtgggagttattat |
35989749 |
T |
 |
| Q |
112 |
agagcagagacgagagtgagagaatccactcactggtcccacaatctggtcttgtgggtccattacaactatgannnnnnnactattttcatgtttcaag |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35989748 |
agagcagagacgagagagagagaatccactcactggtcccacaatctggtctggtgggtccattacaactatgatgtttttactattttcatgtttcaag |
35989649 |
T |
 |
| Q |
212 |
gacaaactttagtcgcttttttg |
234 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
35989648 |
gacaaagtttagtcgcttttttg |
35989626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University