View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2326_low_20 (Length: 250)
Name: NF2326_low_20
Description: NF2326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2326_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 126 - 234
Target Start/End: Original strand, 35327513 - 35327623
Alignment:
| Q |
126 |
aaccccatttgtaaaaattctggatccgtcctttaatgtcaccggaaagagaaatacggggatggaaaatattat----catgcatgattcaacaaaaat |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35327513 |
aaccccatttgtaaa--ttctggatccgtcctttaatgtcaccggaaagagaaatacggggatggaaaatattatcatgcatgcatgattcaacaaaaat |
35327610 |
T |
 |
| Q |
222 |
attatcacaatca |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35327611 |
attatcacaatca |
35327623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University