View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2326_low_24 (Length: 240)
Name: NF2326_low_24
Description: NF2326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2326_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 61 - 221
Target Start/End: Original strand, 24520531 - 24520695
Alignment:
| Q |
61 |
ttttttagattccttatttatttgggtagctgaaataagcagcagatagattccacccaaatgctgtttgataatatgcttctttggccataagaacttc |
160 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24520531 |
ttttttagattccttagttatttgggtagctgaaataagcagcagatagattccacccaaatgctgtttgataatatgcttctttggccataagaacttc |
24520630 |
T |
|
| Q |
161 |
cacttttgtagctta--tctctctctttgaagttcatttttagagag--agagatcaagagttag |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
24520631 |
cacttttgtagcttatctctctctctttgaagctcttttttagagagaaagagatcaagagttag |
24520695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University