View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2326_low_25 (Length: 237)
Name: NF2326_low_25
Description: NF2326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2326_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 12433106 - 12433304
Alignment:
| Q |
23 |
cacaccatgttgggtagacgcatcaaggttttggcaattatgcaatctagttattagtgataaaatgaataagaccctattatcctataaactttaatgc |
122 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12433106 |
cacaccatgttgggtaaacgcatcaaggttttggcaattatgcaatctagttattagtgataaattgaataagaccctattatcctataaacttcaatgc |
12433205 |
T |
|
| Q |
123 |
ttgatgtgcaaatttaatactaccgaacnnnnnnngtagtacagaactcactagaggctgagaaagaccgagaaaaaccaagagaaactattaagaaag |
221 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12433206 |
ttgatgtgcaaatttaatagtaccgaactttttttgtagtacagaactcactagaggctgagaaagaccgagaaaaaccaagagaaactattaagaaag |
12433304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 221
Target Start/End: Original strand, 9235167 - 9235218
Alignment:
| Q |
170 |
tcactagaggctgagaaagaccgagaaaaaccaagagaaactattaagaaag |
221 |
Q |
| |
|
||||||||||| ||| |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
9235167 |
tcactagaggcagaggaagacctagaaaaactaagagaaactattaagaaag |
9235218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 221
Target Start/End: Complemental strand, 26784504 - 26784451
Alignment:
| Q |
170 |
tcactagaggctgagaaagaccgagaaaaac--caagagaaactattaagaaag |
221 |
Q |
| |
|
||||||||||| |||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
26784504 |
tcactagaggcagagaaagacctagaaaaactataagagaaactattaagaaag |
26784451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University