View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2326_low_26 (Length: 237)
Name: NF2326_low_26
Description: NF2326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2326_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 116 - 230
Target Start/End: Complemental strand, 24520268 - 24520154
Alignment:
| Q |
116 |
gagtcaagagggtaattgagaaagtgaaaaagttgtgaagtttgagatgaaaataagcataagtggtggttgtgaaagaagaagtgaagtggaacagaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24520268 |
gagtcaagagggtaattgagaaagtgaaaaagttgtgaagtttgagatgaaaataagcataagtggtggttgtgaaagaagaagtgaagtggaacagaaa |
24520169 |
T |
 |
| Q |
216 |
tgtgtatgatgatgt |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24520168 |
tgtgtatgatgatgt |
24520154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 24520382 - 24520332
Alignment:
| Q |
1 |
agttttagaacatgagggtttttgagtgaaattaagcaactgggtcagttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24520382 |
agttttagaacatgagggtttttgagtgaaattaagcaactgggtcagttt |
24520332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University