View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2326_low_27 (Length: 236)
Name: NF2326_low_27
Description: NF2326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2326_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 48693430 - 48693646
Alignment:
| Q |
5 |
tgcacgactgttttcataatgtttatatagtaannnnnnnnaatcatttactaaaacatgaaaatgaaggaacctgtttttaattcctatgcttcttcat |
104 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48693430 |
tgcacgagtgttttcataatgtttatatagtaattttttttaatcatttactaaaacatgaaaatgaaggaacctgtttttaattcctatgcttcttcat |
48693529 |
T |
 |
| Q |
105 |
tgagattttttagcccttaattttggtttctgaatgttgaaaatcaccttgataacttgcaattgaatttttcacatatttgacttctattttgtttcag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48693530 |
tgagattttttagcccttaattttggtttctgaatgttgaaaatcaccttgataacttgcaattgaatttttcacatatttgacttctattttgtttcag |
48693629 |
T |
 |
| Q |
205 |
agacatattgaaatttg |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48693630 |
agacatattgaaatttg |
48693646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University