View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2327_high_22 (Length: 300)
Name: NF2327_high_22
Description: NF2327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2327_high_22 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 15 - 282
Target Start/End: Original strand, 15785 - 16053
Alignment:
| Q |
15 |
atgaacatgatcataagagtcaattgaacctgctgtgcaatttctccttgttctatcttttcgtgaaaaatatttatgttaagtactagtaaaaagtatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15785 |
atgaacatgatcataagagtcaattgaacctgctgtgcaatttctccttgttctatcttttcgtgaaaaatatttatgttaagtactagtaaaaagtatt |
15884 |
T |
 |
| Q |
115 |
accaaatcaggatagagttgagttataaatgaatgaatgaat-aatataatggaaatcacggctttgcaagatctaatgcagtgactattggcaacatgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15885 |
accaaatcaggatagagttgagttataaatgaatgaatgaataaatataatggaaatcacggctttgcaagatctaatgcagtgactattggcaacatgt |
15984 |
T |
 |
| Q |
214 |
ctttttgagtttgaaaaactgactcagcaacttatgcacttccccatagtttctggaagaagaaacgag |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15985 |
ctttttgagtttgaaaaactgactcagcaacttatgcacttccccatagtttctggaagaagaaacgag |
16053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University