View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2327_high_24 (Length: 271)
Name: NF2327_high_24
Description: NF2327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2327_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 21 - 171
Target Start/End: Original strand, 3920204 - 3920354
Alignment:
| Q |
21 |
tatacaggagtttgtgacaatgatgaattggtttgtgagagcggtggtgaaacggtgattagaggaagagggcgacaatgtgattaaagaaaatgggcga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
3920204 |
tatacaggagtttgtgacaatgatgaattggtttgtgagagcggtggtgaaacggtgattagaggaagagggcgtcgatgtgattaaagaaaatgggcga |
3920303 |
T |
 |
| Q |
121 |
caattgggtggagattgaaggtgacagcgattggtccttttatttgaattg |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3920304 |
caattgggtggagattgaaggtgacagcgattggtccttttatttgaattg |
3920354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 169 - 262
Target Start/End: Original strand, 3920398 - 3920491
Alignment:
| Q |
169 |
ttgcctttgatttgtctaattgtcttgttgaaattaattgttcaacaattcccttgtaatcaacatagggtattatagttgtaattgttcatct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3920398 |
ttgcctttgatttgtctaattgtcttgttgaaattaattgttcaacaattcccttgtaatcaacatagggtattatagttgtaattgttcatct |
3920491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University