View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2327_high_34 (Length: 203)
Name: NF2327_high_34
Description: NF2327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2327_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 503057 - 502885
Alignment:
| Q |
18 |
catcactgtccagttttgaaaccccaactgaacatggtttacatactgaaattgaacctcaagtattggaagctgtagcatattatgagagcaaacatcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
503057 |
catcactgtccagttttgaaaccccaactgaacttggtttacatactgaaattgaacctcaagtatcggaagctgtagcatattatgagagcaaacatcc |
502958 |
T |
|
| Q |
118 |
taccaaggaaacaaatattgaactactaccatcagtctcgatggagattgatgtcgcttcagaggtctgtgct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
502957 |
taccaaggaaacaaatattgaactactaccatcagtctcgatggagattgatgtcgcttcagaggtcagtgct |
502885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 11789722 - 11789558
Alignment:
| Q |
18 |
catcactgtccagttttgaaaccccaactgaacatggtttacatactgaaattgaacctcaagtattggaagctgtagcatattatgagagcaaacatcc |
117 |
Q |
| |
|
||||| |||| ||||||||| ||| ||||||||||||| |||||||||||| |||||||||||||| |||||| |||| || ||||||| || |||||| |
|
|
| T |
11789722 |
catcattgtcaagttttgaacccctaactgaacatggtctacatactgaaactgaacctcaagtatcggaagccgtagtatgttatgagcgccaacatct |
11789623 |
T |
|
| Q |
118 |
taccaaggaaacaaatattgaactactaccatcagtctcgatggagattgatgtcgcttcagagg |
182 |
Q |
| |
|
| | |||| | || |||| ||| |||||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
11789622 |
ttctgaggagataagtattccactgctaccatcaggctcaatggagattgataccgcttcagagg |
11789558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 92
Target Start/End: Original strand, 15440169 - 15440243
Alignment:
| Q |
18 |
catcactgtccagttttgaaaccccaactgaacatggtttacatactgaaattgaacctcaagtattggaagctg |
92 |
Q |
| |
|
||||| |||| ||| ||||| || ||||||||||||| ||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
15440169 |
catcagtgtcaagtgttgaactcctaactgaacatggtctacatactgcagttgaacctcaagtatcggaagctg |
15440243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University