View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2327_low_20 (Length: 315)
Name: NF2327_low_20
Description: NF2327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2327_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 22 - 298
Target Start/End: Original strand, 41343710 - 41343986
Alignment:
| Q |
22 |
gtgagctaaatttactagactaatcgttctctttctaaatagataaacattaaagaaaacaagatattacctatagtcccaaccacaatttgccatgtga |
121 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41343710 |
gtgagctaaatttactagactaatcattctctttctaaatagataaacattaaaggaaacaagatattacctatagttccaaccacaatttgccatgtga |
41343809 |
T |
 |
| Q |
122 |
tttccacaggagccggatcaagtactgtggttacatcactcacagacacaacacctatccttgttcttctttttgttgttgttctagcattcttaacccc |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41343810 |
tttcgacaggagccggatcaagtactgtggttacatcactcacagacacaacacctatccttgttcttctttttgttgttgttcttgcattcttaacccc |
41343909 |
T |
 |
| Q |
222 |
aaaatcacaggtttttctcactgttgaggaacaacaattatgtgtaactatgttcctagctttggcaatagttaaag |
298 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||| | |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41343910 |
aaaatcccaggtttttctcactgttaaggaacaacaatcacgtgtaactatgttcctagctttggtaatagttaaag |
41343986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University