View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2327_low_28 (Length: 259)
Name: NF2327_low_28
Description: NF2327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2327_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 9769805 - 9769575
Alignment:
| Q |
1 |
aaaggtatagggaatctcaagcactaaaatttatcatataggatcaagaaacgtgcataaaataaagaaga---taaggaagtgggagtgagtgattctg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9769805 |
aaaggtatagggaatctcaagcactaaaaattatcatataggatcaagaaacgtgcataaaataaagaagaagataaggaagtgggagtgagtgattctg |
9769706 |
T |
 |
| Q |
98 |
tataaaagtgagagcaaatgcatattttgcataatgcat---ttactactagtaccgtgactttattcggttatttagttgataaaacaattttgtaatt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
9769705 |
tataaaagtgagagcaaatgcatattttgcataatgcatgtgttactactagtaccgtgactttattctgtta-ttagttgataaaacaattttgtaatt |
9769607 |
T |
 |
| Q |
195 |
attttaaaattactattttagccctcagaaca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9769606 |
attttaaaattactattttagccctcagaaca |
9769575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University