View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2327_low_33 (Length: 239)
Name: NF2327_low_33
Description: NF2327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2327_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 44322153 - 44322355
Alignment:
| Q |
19 |
agactaaaattatctttaccatacaatgagattttaattaagtaattgggattgactgcagagataataagagctgcttcaagtattgaagcttagttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44322153 |
agactaaaattatctttaccatacaatgagattttaattaagtaattgggattgactgcagagataataagagctgcttcaagtattgaagcttagttat |
44322252 |
T |
|
| Q |
119 |
tccttcaaaatggattcttgaatttagctaagtaatttttagagttctcttttgaaataaatcaataatatggattggtgttgtgagacagttgcgtcga |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44322253 |
tccttcaaaatggattgttgaatttagctaagtaatctttagagttctcttttgaaataaatcaataatatggattggtgttgtgagaccgttgcgtcga |
44322352 |
T |
|
| Q |
219 |
ata |
221 |
Q |
| |
|
||| |
|
|
| T |
44322353 |
ata |
44322355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University