View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2327_low_35 (Length: 227)
Name: NF2327_low_35
Description: NF2327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2327_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 43710422 - 43710641
Alignment:
| Q |
1 |
atggatcatttgtgtaggcttagctcaataatcctatgtgaattttaggtaccaaaacaccaaaaagcaaacagttgagaaaggtcccatccgtgcgaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43710422 |
atggatcatttgtgtaggcttagctcaataatcctatgtgaattttaggtaccaaaacaccaaaaagcaaacagttgagaaaggtcccatccgtgcgaca |
43710521 |
T |
 |
| Q |
101 |
acagaatccaaagtccaaaccatatgcaat-caaccaaacagtttacctcttattcnnnnnnncaattaatgtaaccccattttgcttcctgctttggct |
199 |
Q |
| |
|
|||||||||||||||| |||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43710522 |
acagaatccaaagtcccaaccatatgccatacaaccaaacagtttacctcttattctttttttcaattaatgtaaccccattttgcttcctgctttggct |
43710621 |
T |
 |
| Q |
200 |
agatgtgtgtctttcatctc |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43710622 |
agatgtgtgtctttcatctc |
43710641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University