View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_high_40 (Length: 252)
Name: NF2329_high_40
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_high_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 45089524 - 45089296
Alignment:
| Q |
1 |
ccacatcggtcacgctctagatgttcaatccagggtatgagaggtgtggtaagagtctcactctgaaaatggtatagcatgaacaaatgtttataagtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45089524 |
ccacatcggtcacgctctagatgttcaatctagggcatgagaggtgtggtaagagtctcactctgaaaatggtatagcatgaacaaatgtttataagtga |
45089425 |
T |
|
| Q |
101 |
cgtcagtcttcccacgtgggtataggacgggcacaagtatcatatttatccaacggggacggggacgaggacgagtttcatactatttgtactcatagat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | || |||| || ||||||||| ||||||||||||| |
|
|
| T |
45089424 |
cgtcagtcttcccacgtgggtataggacgggcacaagtatcatatttatccaa------cgggaatgaagacgggtatcatactatctgtactcatagat |
45089331 |
T |
|
| Q |
201 |
atccaatgacatctctaggtgtgaaggaggtgggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45089330 |
atccaatgacatctctaggtgtgaaggaggtgggt |
45089296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University