View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_high_46 (Length: 239)
Name: NF2329_high_46
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 38 - 221
Target Start/End: Original strand, 279979 - 280169
Alignment:
| Q |
38 |
aaaggtattattatgaaaattaaggggacaactacattacccttcaatttgtcnnnnnnnnctacattacacatcaacaaaaatgtgggtagagtta--- |
134 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
279979 |
aaaggtattattatgaaaattaaggtgacaactacattacccttcaatttatcaaaaaaaactacattacacatcaacaaaa-tgtggatagagttactc |
280077 |
T |
 |
| Q |
135 |
-----gggttgacatcaatcaaaattattcatttgttttccactataagaatgattttgattaatggcaactcggtataaacaactttaccc |
221 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
280078 |
atatcggattgacatcaatcaaaattattcatttgttttctactataagaatgattttgattaatggcaactcagtataaacaactttaccc |
280169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University