View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_high_52 (Length: 231)
Name: NF2329_high_52
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 215
Target Start/End: Original strand, 34812942 - 34813147
Alignment:
| Q |
10 |
actgagatgaacattttgaaacctgtggcacttcactcgtgcaaggcttgacttgcatatatgaacccaaagcttcagaaccatctagcttatatgaatg |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34812942 |
actgaaatgaacattttgaaacctgtggcacttcactcgtgcaaggcttgacttgcatatatgaacccaaagcttcagaaccatctaacttatatgaatg |
34813041 |
T |
 |
| Q |
110 |
agatttattctccttgtcccacttgctcattgttagctgccatgaagaaaatgaagttattggaagaaaattatgtgtattagactctctcgacggtcaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
34813042 |
agatttattctccttgtcccacttgctcattgttagctgccatgaagaaaatgaagttattggaagaaaattatgtgtattagtctctctcaacggtcaa |
34813141 |
T |
 |
| Q |
210 |
tcaaac |
215 |
Q |
| |
|
|||||| |
|
|
| T |
34813142 |
tcaaac |
34813147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University