View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_high_53 (Length: 230)
Name: NF2329_high_53
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_high_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 30033593 - 30033802
Alignment:
| Q |
1 |
cccctttctacactggtaattcaccaatcaccgcctcactagtatttatccatggtgccacagtcataggaaatttggatcctgaacctcctctttaacc |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
30033593 |
cccctttctacactggtatttcaccaatcaccgcctcaccagtaactatccatggtgccacggtcataagaaatttggatccagaacctcctctttaacc |
30033692 |
T |
 |
| Q |
101 |
-gtgtctgcagatgttatgttttgagggaggtagtttcaaatagatttcgacttgcagaaaattcaattcatggccttcacaatcacaaccacctccatt |
199 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30033693 |
tgtgtctgcagatgttttgttttgatggaggtactttcaaatagacttcgacttgcagaaaattcaattcatgaccttcacaatcacaaccacctccatt |
30033792 |
T |
 |
| Q |
200 |
gttggaggaa |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
30033793 |
gttggaggaa |
30033802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 23147656 - 23147447
Alignment:
| Q |
1 |
cccctttctacactggtaattcaccaatcaccgcctcactagtatttatccatggtgccacagtcataggaaatttggatcctgaacctcctctttaacc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
23147656 |
cccctttctacactggtatttcaccaatcaccgcctcactagtaactatccatggtgccacggtcataggaaatttggatctagaacctcctctataacc |
23147557 |
T |
 |
| Q |
101 |
-gtgtctgcagatgttatgttttgagggaggtagtttcaaatagatttcgacttgcagaaaattcaattcatggccttcacaatcacaaccacctccatt |
199 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||||||||| ||||||| |||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
23147556 |
tgtgtctgcagatgttttgttttgatggaggtagtttcgaatagatttcaacttgcaaaaaattcaattcatggccttaacaatcacaaccgcctccatt |
23147457 |
T |
 |
| Q |
200 |
gttggaggaa |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
23147456 |
gttggaggaa |
23147447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University