View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_20 (Length: 388)
Name: NF2329_low_20
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 201 - 373
Target Start/End: Complemental strand, 16832798 - 16832629
Alignment:
| Q |
201 |
ttctagaggttttggcttttcctctttattctaatcacattcaaacttttgttgttatatgtattttagttgagtattgcccaagtactataagcataat |
300 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16832798 |
ttctaggggttttggcttttcctttttattctaatcacataaaaacttttgtt---atatgtattttagttgagtatttcccaagtactataagcataat |
16832702 |
T |
 |
| Q |
301 |
gcataatcaaagactcgcattaattcatttaagtttgcacgtgaccctggccctaaccttctcccgttttcat |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
16832701 |
gcataatcaaagactcgcattaattcatttcagtttgcaggtgaccctggccctaaccttaacccgtcttcat |
16832629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 306
Target Start/End: Original strand, 16573347 - 16573400
Alignment:
| Q |
252 |
ttgttatatgtatttt-agttgagtattgcccaagtactataagcataatgcataa |
306 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |||||| ||||||||| |
|
|
| T |
16573347 |
ttgttatatgtattttcagttgagtatttcccaagtac--taagcacaatgcataa |
16573400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University