View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_21 (Length: 378)
Name: NF2329_low_21
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 173 - 291
Target Start/End: Complemental strand, 5508979 - 5508861
Alignment:
| Q |
173 |
cattggtacattgatgatgaatattttgagacattttagtttaagagaaattacaaaactgagattttagttgtttttcttaccagagcaaagaaagaga |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5508979 |
cattgatacattgatgatgaatattttgagacattttagtttaagagaaattacaaaactgagattttagttgtttttcttaccagagcaaagaaagaga |
5508880 |
T |
|
| Q |
273 |
agatgaaatagacacacca |
291 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5508879 |
agatgaaatagacacacca |
5508861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 7 - 99
Target Start/End: Complemental strand, 5509145 - 5509053
Alignment:
| Q |
7 |
gtgagatgaagatgttgcaatgtcttcacttgtttcacataggttaaggaactcaatgttttcttgaccagaaactacaatgcaaactacaac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509145 |
gtgagatgaagatgttgcaatgtcttcacttgtttcacataggttaaggaactcaatgttttcttgaccagaaactacaatgcaaactacaac |
5509053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 325 - 362
Target Start/End: Complemental strand, 5508842 - 5508805
Alignment:
| Q |
325 |
gtgccaataatctcaaggtttctcacggtcttgtattg |
362 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5508842 |
gtgccaataatctcaaggtttctcactgtcttgtattg |
5508805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University