View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_22 (Length: 372)
Name: NF2329_low_22
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 6 - 221
Target Start/End: Original strand, 23407061 - 23407278
Alignment:
| Q |
6 |
taattgtatttaagtttcttaaagaaaaaatgttttgtgctgattgcaaacaagagatttcagatt--caaattaaagaggatttgattggtaaataaat |
103 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
23407061 |
taattgtattaaagtttcttaaagataaaatgttttgtgctgattgcaaacaagagatctcagaataacaaattaaagaggatttgattggtaaataaat |
23407160 |
T |
|
| Q |
104 |
aaatgggattgcattccttttcggtgttttaaagctagcgatttgtttttatcattatggtaacagaatgtcaatggtatcctagtttttatgttaatta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23407161 |
aaatgggattgcattccttttcggtgttttaaagctaccgatttgtttttatcattatcgtaacagaatgtcaatggtatcctagtttttatgttaatta |
23407260 |
T |
|
| Q |
204 |
tctcacaattttagtgat |
221 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
23407261 |
tctcacagttttagtgat |
23407278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 224 - 350
Target Start/End: Original strand, 23407338 - 23407465
Alignment:
| Q |
224 |
agacagatccttctcactatatatggatggagatgtaagttggtctctcaccattttatgaatgt-aggtcaattatttccatcatactcgttatcacaa |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | || ||||| |||||||||||||| ||||||||| |
|
|
| T |
23407338 |
agacagatccttctcactatatatggatggagatgtaagttggtctctcaccatttcatgaatatcagtccaattctttccatcatactcattatcacaa |
23407437 |
T |
|
| Q |
323 |
cactttttcttcttaaaaccatggaaaa |
350 |
Q |
| |
|
| | |||||||||||||||||||||||| |
|
|
| T |
23407438 |
cgcgttttcttcttaaaaccatggaaaa |
23407465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University