View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_25 (Length: 335)
Name: NF2329_low_25
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 30101981 - 30102201
Alignment:
| Q |
1 |
aagatactccgattatacggattactgtctcatttgatattgaagattcattcatatcttcttgcgaaaagaaacaaaagattcattcatatctcatttg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30101981 |
aagatactccgattatacggattcctgtctcatttgatattgaagattcattcatatcttcttgcgaaaagaaacaaaagattcattgatatct------ |
30102074 |
T |
|
| Q |
101 |
atatttgataacgatatcattcttgtatttctatgacacaacacatattttgttaagttaacttgacaaatgacattgacggtacacaatgcgtacagta |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30102075 |
-tatttgataacgacatcattcttgtatttctatgacacaacacatattttgttaagtttacttgacaaatgacattgacggtacacaatgcgtacagta |
30102173 |
T |
|
| Q |
201 |
cattctagataatttaaatatggatttt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30102174 |
cattctagataatttaaatatggatttt |
30102201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 317
Target Start/End: Original strand, 30102238 - 30102270
Alignment:
| Q |
285 |
gaatctatatttacgatgaattattaagaaatg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30102238 |
gaatctatatttacgatgaattattaagaaatg |
30102270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University