View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_32 (Length: 323)
Name: NF2329_low_32
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 12 - 305
Target Start/End: Original strand, 28530351 - 28530644
Alignment:
| Q |
12 |
catcatcaccaggaggaggagatggagggcaccaatggaaggctatgattgatgcattgaggtttaagtctgtgaggagattttctaccattcctttgct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28530351 |
catcatcaccaggaggaggagatggagggcaccaatggaaggctatgattgatgcattgaggtttaagtctgtgaggagattttctagcattcctttgct |
28530450 |
T |
 |
| Q |
112 |
tgctgctagttatgaaatttctaggaagaatttgaggaacaagttggctcgtaaaagaacagctaacgatgaagatgagaatatttttgatgctgctttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530451 |
tgctgctagttatgaaatttctaggaagaatttgaggaacaagttggctcgtaaaagaacagctaacgatgaagatgagaatatttttgatgctgctttt |
28530550 |
T |
 |
| Q |
212 |
gatcttgatggtattacaaagccttcttggagaaactttagttatgaagatcttgttgctgcaaccgacaatttcaatcctggtaaggaattag |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530551 |
gatcttgatggtattacaaagccttcttggagaaactttagttatgaagatcttgttgctgcaaccgacaatttcaatcctggtaaggaattag |
28530644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University