View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_35 (Length: 310)
Name: NF2329_low_35
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 23 - 297
Target Start/End: Original strand, 14415907 - 14416180
Alignment:
| Q |
23 |
acacatgttgtctatttatagtgagtctttatttttattggttgctttctaatccgttgaggtagccatatttaacgaatgagtcttaacccatgttttt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14415907 |
acacatgttgtctatttatagtgagtctttatttttattggttgctttcgaatccgttgaggtagccatatttaacgaatgagtcttaacccatgttttt |
14416006 |
T |
 |
| Q |
123 |
tataaacnnnnnnnnctcctatttaagctatatttgaataaaacatattgttt-nnnnnnnnntgcagagtttctcgatcattttcattttgttgtgtat |
221 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14416007 |
tataaacttttttttctcctatttaagctatatttgaataaaacatattgtttaaaaaaaaaatgcagagtttctcgatcattttcattttgttgtgtat |
14416106 |
T |
 |
| Q |
222 |
tcagatcatttgcctgtctcttaactatataaacttgagaggagtcgtttattaatattgtctcaatcacattcat |
297 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14416107 |
tcagatcatttgcctgtctcttaac--tataaacttgagaggagtcgtttattaatattgtctcaatcacattcat |
14416180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University