View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_39 (Length: 298)
Name: NF2329_low_39
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 162 - 252
Target Start/End: Original strand, 48966374 - 48966463
Alignment:
| Q |
162 |
gtgatatgttagatgaatgacctttaccaaaattttcatgctaatcaatctatcaaatcatcatcttactatgatattgaggttatattct |
252 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48966374 |
gtgatatattagatgaatgacctttaccaaaattttcatgctaatcaatcaatc-tatcatcatcttactatgatattgaggttatattct |
48966463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 27 - 88
Target Start/End: Original strand, 48966260 - 48966317
Alignment:
| Q |
27 |
taatatagctttgacataatgaactcagttatcatcttaattattcgttgagtgattatatg |
88 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
48966260 |
taatttagctttgacataatgaactctgttatcatc----ttattcgttgagtgattatatg |
48966317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 285
Target Start/End: Original strand, 48966496 - 48966530
Alignment:
| Q |
251 |
ctcctaaagtaacgtgctcattctttaattattat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48966496 |
ctcctaaagtaacgtgctcattctttaattattat |
48966530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University