View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2329_low_40 (Length: 297)

Name: NF2329_low_40
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2329_low_40
NF2329_low_40
[»] chr8 (1 HSPs)
chr8 (159-279)||(9694893-9695013)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 159 - 279
Target Start/End: Original strand, 9694893 - 9695013
Alignment:
159 cgacacaatcccaccatcaccaactctctccaattcctctatcgatttccttccaaacttctccggttactcatggatcgcttatggagcttcttccctt 258  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9694893 cgacacaatcccaccatcaccaactctctccaattccactatcgatttccttccaaacttctccggttactcatggatcgcttatggagcttcttccctt 9694992  T
259 ctcgtcatcacccatttccct 279  Q
    |||||||||||||||||||||    
9694993 ctcgtcatcacccatttccct 9695013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University