View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_40 (Length: 297)
Name: NF2329_low_40
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 159 - 279
Target Start/End: Original strand, 9694893 - 9695013
Alignment:
| Q |
159 |
cgacacaatcccaccatcaccaactctctccaattcctctatcgatttccttccaaacttctccggttactcatggatcgcttatggagcttcttccctt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9694893 |
cgacacaatcccaccatcaccaactctctccaattccactatcgatttccttccaaacttctccggttactcatggatcgcttatggagcttcttccctt |
9694992 |
T |
|
| Q |
259 |
ctcgtcatcacccatttccct |
279 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9694993 |
ctcgtcatcacccatttccct |
9695013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University