View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2329_low_41 (Length: 286)
Name: NF2329_low_41
Description: NF2329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2329_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 275
Target Start/End: Original strand, 56043360 - 56043616
Alignment:
| Q |
19 |
cttcccatcggaaagttcatggccgccactcttcccaccaaagagtataacttttttgggcggtggcgtttcacgttgaatcctggtccgtttaatatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043360 |
cttcccatcggaaagttcatggccgccactcttcccaccaaagagtataacttttttgggcggtggcgtttcacgttgaatcctggtccgtttaatatga |
56043459 |
T |
 |
| Q |
119 |
aggagcatgttattatcactatttttgctaactgtggtgtttctcaaggtggtggtgatgcttactccattggtgctattactattatgaaagcttatta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043460 |
aggagcatgttattatcactatttttgctaactgtggtgtttctcaaggtggtggtgatgcttactccattggtgctattactattatgaaagcttatta |
56043559 |
T |
 |
| Q |
219 |
caaacaatctctcagttttctccttgctctattcatcgtcttaaccacacaggttct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043560 |
caaacaatctctcagttttctccttgctctattcatcgtcttaaccacacaggttct |
56043616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University